Home About Browse Search
Svenska


Reactivity of human and porcine natural interferon-alpha producing cells to immunostimulatory DNA

Magnusson, Mattias (2003). Reactivity of human and porcine natural interferon-alpha producing cells to immunostimulatory DNA. Diss. (sammanfattning/summary) Uppsala : Sveriges lantbruksuniv., Acta Universitatis agriculturae Sueciae. Veterinaria, 1401-6257 ; 159
ISBN 91-576-6389-0
[Doctoral thesis]

[img]
Preview
PDF
429kB

Abstract

The interferon-α (IFN-α) inducing capacity of various forms of immunostimulatory DNA and the identity of the IFN-α producing cells (IPC) were studied in human and porcine leukocytes. The DNA vaccine vector pcDNA3 induced production of IFN-α in porcine peripheral blood mononuclear cells (PBMC), but only if used with the transfecting agent lipofectin. Unmethylated CpG dinucleotides in the plasmid were necessary for induction of IFN-α, but pcDNA3 retained this ability after mutation of the CpG-motifs (5’AACGTT 3’) in the ampicillin resistance gene. Lipofection and presence of an unmethylated CpG were also prerequisites for the ability of the double stranded (ds) phosphodiester oligodeoxyribonucleotide (ODN) H (5’ TTTTCAATTCGAAGATGAAT 3’) to activate production of IFN-α in human and porcine PBMC. Human, but not porcine, PBMC could still produce high levels of IFN-α in response to certain single stranded (ss) ODNs, devoid of unmethylated CpG dinucleotides. This indicates that there are species differences in the recognition of immunostimulatory DNA and that eukaryotic DNA sometimes can be interferogenic. Certain CpG-containing ODNs with flanking poly-G sequences were very potent inducers of IFN-α production in the absence of lipofectin, both as phosphorothioate/ phosphodiester chimeric ODNs or as phosphodiester ODNs. Addition of poly-G sequences to the phosphodiester ODN H clearly enhanced its activity, but did not replace the need for lipofectin. The natural IFN-α producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), were the only cells among human or porcine PBMC that produced IFN-α in response to immunostimulatory DNA. The human NIPC/PDC also produce IFN-α in response to apoptotic cells in combination with autoantibodies from patients with systemic lupus erythematosus (SLE). This activation was dependent on Fcγ-receptor type II (FcγRII), and the NIPC/PDC were shown to express FcγRIIa, but not the FcγRIIb/c isoforms. The FcγRIIa may also be inhibitory, because aggregated IgG that binds FcγR had a general inhibitory effect on IFN-α production induced by immunostimulatory DNA or herpes simplex virus. Elucidation of the mechanisms whereby NIPC/PDC are activated may result in more efficient vaccine adjuvants and also provide new targets aiming at inhibition of the pathologic activation of NIPC/PDC in autoimmune diseases.

Authors/Creators:Magnusson, Mattias
Title:Reactivity of human and porcine natural interferon-alpha producing cells to immunostimulatory DNA
Year of publishing :September 2003
Volume:159
Number of Pages:49
Papers/manuscripts:
NumberReferences
ALLI. Magnusson, M., Johansson, E., Berg, M., Eloranta, M-L., Fuxler, L. & Fossum, C. 2001. The plasmid pcDNA3 differentially induces production of interferon-α and interleukin-6 in cultures of porcine leukocytes. Veterinary Immunology and Immunopathology 78, 45-56. II. Magnusson, M., Magnusson, S., Vallin, H., Rönnblom, L. & Alm, G. V. 2001. Importance of CpG dinucleotides in activation of natural interferon-α producing cells by a lupus-related oligodeoxynucleotide. Scandinavian Journal of Immunology 54, 543-550. III. Domeika, K., Magnusson, M. Eloranta, M-L., Fuxler, L., Alm, G. V. & Fossum, C. Characteristics of oligodeoxyribonucleotides that induce interferon-α (IFN-α) in the pig and the phenotype of the IFN-α producing cells. Manuscript submitted for publication. IV. Båve, U., Magnusson, M., Eloranta, M-L., Perers, A., Alm, G. V. & Rönnblom, L. 2003. FcγRIIa is expressed on natural IFN-α producing cells (plasmacytoid dendritic cells) and is required for the IFN-α production induced by apoptotic cells combined with lupus IgG. The Journal of Immunology 171, 3296-302.
Place of Publication:Uppsala
ISBN for printed version:91-576-6389-0
ISSN:1401-6257
Language:English
Publication Type:Doctoral thesis
Full Text Status:Public
Agris subject categories.:X Agricola extesions > X30 Life sciences
Subjects:Not in use, please see Agris categories
Agrovoc terms:interferons, cells, dna
Keywords:CpG-DNA, interferon inducer, dendritic cells, natural interferon-α producing cells, type I IFN, FcγRII
URN:NBN:urn:nbn:se:slu:epsilon-77
Permanent URL:
http://urn.kb.se/resolve?urn=urn:nbn:se:slu:epsilon-77
ID Code:357
Department:(VH) > Dept. of Molecular Biosciences (until 070101)
Deposited By: Mattias Magnusson
Deposited On:17 Sep 2003 00:00
Metadata Last Modified:02 Dec 2014 10:04

Repository Staff Only: item control page

Downloads

Downloads per year (since September 2012)

View more statistics

Downloads
Hits